SPECIAL NOTICE
Q -- Custom phosphorylated oligo synthesis for APP
- Notice Date
- 2/16/2024 6:08:19 AM
- Notice Type
- Special Notice
- NAICS
- 541380
— Testing Laboratories
- Contracting Office
- NATIONAL INSTITUTES OF HEALTH NIDA Bethesda MD 20892 USA
- ZIP Code
- 20892
- Solicitation Number
- 75N95024Q00130
- Response Due
- 2/28/2024 1:00:00 PM
- Archive Date
- 03/14/2024
- Point of Contact
- Maggie Brant, Phone: 3018271771, KJ Shaikh, Phone: 3014436677
- E-Mail Address
-
maggie.brant@nih.gov, kj.shaikh@nih.gov
(maggie.brant@nih.gov, kj.shaikh@nih.gov)
- Description
- NOTICE OF INTENT to Sole Source SOLICITATION NUMBER: ��75N95024Q00130 TITLE: �Custom phosphorylated oligo synthesis for APP CLASSIFICATION CODE: Q301� MEDICAL- LABORATORY TESTING NAICS CODE: 541380 - Testing Laboratories and Services RESPONSE DATE: February 28, 2024 at 4:00 PM EST PRIMARY POINT OF CONTACT: Maggie Brant Maggie.brant@nih.gov Phone: 301.827.1771 DESCRIPTION: INTRODUCTION THIS IS A PRE-SOLICITATION NON-COMPETITIVE (NOTICE OF INTENT) SYNOPSIS TO AWARD A CONTRACT WITHOUT PROVIDING FOR FULL OR OPEN COMPETITION (INCLUDING BRAND-NAME). The National Center for Advancing Translational Sciences (NCATS) intends to negotiate on a sole source basis with TriLink Biotechnologies, LLC for custom RNA oligos to support assay development. NORTH AMERICAN INDUSTRY CLASSIFICATION SYSTEM (NAICS) CODE and SET ASIDE STATUS The intended procurement is classified under NAICS code 541380 - Testing Laboratories and Services with a Size Standard of $19 million. � REGULATORY AUTHORITY This acquisition is conducted under the authority of the Federal Acquisition Regulation (FAR) Part 13�Simplified Acquisition Procedures. Contracts awarded using FAR Part 13�Simplified Acquisition Procedures are exempt from the requirements of FAR Part 6�Competition Requirements. FAR Subpart 13.106-1 (b) Soliciting from a single source provides that: For purchases not exceeding the simplified acquisition threshold, Contracting officers may solicit from one source IF the contracting officer determines that the circumstances of the contract action deem only one source reasonably available (e.g., urgency, exclusive licensing agreements, brand-name OR industrial mobilization). The resultant contract will include all applicable provisions and clauses in effect through the Federal Acquisition Circular (FAC) Number 2024-02, with effective date 1/22/24. DESCRIPTION OF REQUIREMENT PURPOSE AND OBJECTIVES: RNA methyltransferases are used by many viruses to cap their RNA transcripts and evade the immune system. Developing inhibitors of these enzymes is a promising route for antiviral drug development. To this end, we need synthetic RNA oligos with the proper 5` phosphorylation to run assays for antiviral drug development. Custom RNA Synthesis by Trilink provides the necessary RNA substrates needed to support antiviral research at NCATS. These RNA are used in drug screening assays for a variety of viral methyltransferases within APP. These RNAs are a necessary component of the assay as they are the enzymatic substrates processed by viral methyltransferases. SPECIFIC REQUIREMENTS: QTY 1 Oligo 2 5� {PPP.}AUGGCUGCGUGAGACACACGUAGCCUACCA 3� PO RNA {PPP.} indicates 5' Triphosphate 100 ?mole starting synthesis scale HPLC Purification Delivery Date: 4-6 weeks from receipt of PO CONTRACTING WITHOUT PROVIDING FOR FULL OR OPEN COMPETITION (INCLUDING BRAND-NAME) DETERMINATION The determination by the Government to award a contract without providing for full and open competition is based upon the market research conducted. Specifically, TriLink Biotechnologies, LLC is the only vendor in the marketplace that can provide the custom oligo synthesis listed herein is available from only one source due to the specificity of the modifier and the incorporation of di or triphosphate modifications in the custom oligo synthesis. Competition is precluded for the reasons indicated below. There are no substitutes available due to the specificity of the modifier and the incorporation of di or triphosphate modifications in the custom oligo synthesis. The intended source is: TriLink Biotechnologies, LLC 10770 Wateridge Cir Ste 200 San Diego, CA 92121-5801 CLOSING STATEMENT THIS SYNOPSIS IS NOT A REQUEST FOR COMPETITIVE PROPOSALS. However, interested parties may identify their interest to receive a Request for Quotation (RFQ) and capability to respond to this notice. A determination by the Government not to compete this proposed contract based upon responses to this notice is solely within the discretion of the Government. All responsible sources may submit a capability statement, proposal, or quotation which shall be considered by the agency. The information received will normally be considered solely for the purposes of determining whether to proceed on a non-competitive basis or to conduct a competitive procurement. Responses to this notice shall contain sufficient information to establish the interested parties' bona-fide capabilities for fulfilling the requirement and include: unit price, list price, shipping and handling costs, the delivery period after contract award, the prompt payment discount terms, the F.O.B. Point (Destination or Origin), the Unique Entity Identifier (UEI), the Taxpayer Identification Number (TIN), and the certification of business size. All offerors must have an active registration in the System for Award Management (SAM) www.sam.gov. All responses must be received by the closing date and time of this announcement and must reference the solicitation number, 75N95024Q00130. Responses must be submitted electronically to Maggie Brant, Contract Specialist, at maggie.brant@nih.gov.� U.S. Mail and fax responses will not be accepted.
- Web Link
-
SAM.gov Permalink
(https://sam.gov/opp/36eb662779e345dfbeb2a5b6cfbd50ab/view)
- Place of Performance
- Address: Rockville, MD 20850, USA
- Zip Code: 20850
- Country: USA
- Zip Code: 20850
- Record
- SN06968710-F 20240218/240216230054 (samdaily.us)
- Source
-
SAM.gov Link to This Notice
(may not be valid after Archive Date)
| FSG Index | This Issue's Index | Today's SAM Daily Index Page |